biorad imaging station Search Results


99
Bio-Rad chemidoc mp imaging station
Chemidoc Mp Imaging Station, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/chemidoc mp imaging station/product/Bio-Rad
Average 99 stars, based on 1 article reviews
chemidoc mp imaging station - by Bioz Stars, 2026-04
99/100 stars
  Buy from Supplier

90
Bio-Rad chemidoc station
Chemidoc Station, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/chemidoc station/product/Bio-Rad
Average 90 stars, based on 1 article reviews
chemidoc station - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

99
Bio-Rad biorad imaging station
Biorad Imaging Station, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/biorad imaging station/product/Bio-Rad
Average 99 stars, based on 1 article reviews
biorad imaging station - by Bioz Stars, 2026-04
99/100 stars
  Buy from Supplier

90
Bio-Rad kodak image station 2000r
Kodak Image Station 2000r, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/kodak image station 2000r/product/Bio-Rad
Average 90 stars, based on 1 article reviews
kodak image station 2000r - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Bio-Rad geldoc1000 image analysis station
Geldoc1000 Image Analysis Station, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/geldoc1000 image analysis station/product/Bio-Rad
Average 90 stars, based on 1 article reviews
geldoc1000 image analysis station - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Bio-Rad versa doc imaging station
Versa Doc Imaging Station, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/versa doc imaging station/product/Bio-Rad
Average 90 stars, based on 1 article reviews
versa doc imaging station - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Bio-Rad gel doc station
Gel Doc Station, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gel doc station/product/Bio-Rad
Average 90 stars, based on 1 article reviews
gel doc station - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Bio-Rad gel doc 2000 chemiluminescent imaging documentation station
Gel Doc 2000 Chemiluminescent Imaging Documentation Station, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gel doc 2000 chemiluminescent imaging documentation station/product/Bio-Rad
Average 90 stars, based on 1 article reviews
gel doc 2000 chemiluminescent imaging documentation station - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Bio-Rad gel-doc imaging station
Gel Doc Imaging Station, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gel-doc imaging station/product/Bio-Rad
Average 90 stars, based on 1 article reviews
gel-doc imaging station - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

99
Bio-Rad biorad chemidoc mp station
Biorad Chemidoc Mp Station, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/biorad chemidoc mp station/product/Bio-Rad
Average 99 stars, based on 1 article reviews
biorad chemidoc mp station - by Bioz Stars, 2026-04
99/100 stars
  Buy from Supplier

90
Bio-Rad chemidoc xrs image station
A) RT-PCR reaction products generated with RNA isolated from normoxic and hypoxic P14 brains (n=4) are shown for the nuclear PGC-1α and NRF-1 and the mitochondrial transcription factor A Tfam. Bar graphs represent relative signal intensities captured and analyzed by BioRad <t>ChemiDoc</t> <t>XRS</t> Image station with Quantity One software obtained for 3 PCR amplification for each reverse transcription reaction and expressed as mean±SD. * denotes different from normoxic P14, P<0.05. B) Corresponding Western blotting analyses of NRF-1 and Tfam in protein extracts prepared from normoxic and hypoxic P14 brains (n=4). Molecular weight range is indicated for reference and β-actin signal is shown as loading control.
Chemidoc Xrs Image Station, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/chemidoc xrs image station/product/Bio-Rad
Average 90 stars, based on 1 article reviews
chemidoc xrs image station - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Bio-Rad chemidoc image capture station
A) RT-PCR reaction products generated with RNA isolated from normoxic and hypoxic P14 brains (n=4) are shown for the nuclear PGC-1α and NRF-1 and the mitochondrial transcription factor A Tfam. Bar graphs represent relative signal intensities captured and analyzed by BioRad <t>ChemiDoc</t> <t>XRS</t> Image station with Quantity One software obtained for 3 PCR amplification for each reverse transcription reaction and expressed as mean±SD. * denotes different from normoxic P14, P<0.05. B) Corresponding Western blotting analyses of NRF-1 and Tfam in protein extracts prepared from normoxic and hypoxic P14 brains (n=4). Molecular weight range is indicated for reference and β-actin signal is shown as loading control.
Chemidoc Image Capture Station, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/chemidoc image capture station/product/Bio-Rad
Average 90 stars, based on 1 article reviews
chemidoc image capture station - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

Image Search Results


A) RT-PCR reaction products generated with RNA isolated from normoxic and hypoxic P14 brains (n=4) are shown for the nuclear PGC-1α and NRF-1 and the mitochondrial transcription factor A Tfam. Bar graphs represent relative signal intensities captured and analyzed by BioRad ChemiDoc XRS Image station with Quantity One software obtained for 3 PCR amplification for each reverse transcription reaction and expressed as mean±SD. * denotes different from normoxic P14, P<0.05. B) Corresponding Western blotting analyses of NRF-1 and Tfam in protein extracts prepared from normoxic and hypoxic P14 brains (n=4). Molecular weight range is indicated for reference and β-actin signal is shown as loading control.

Journal:

Article Title: SUSTAINED HYPOXIA MODULATES MITOCHONDRIAL DNA CONTENT IN THE NEONATAL RAT BRAIN

doi: 10.1016/j.freeradbiomed.2007.11.005

Figure Lengend Snippet: A) RT-PCR reaction products generated with RNA isolated from normoxic and hypoxic P14 brains (n=4) are shown for the nuclear PGC-1α and NRF-1 and the mitochondrial transcription factor A Tfam. Bar graphs represent relative signal intensities captured and analyzed by BioRad ChemiDoc XRS Image station with Quantity One software obtained for 3 PCR amplification for each reverse transcription reaction and expressed as mean±SD. * denotes different from normoxic P14, P<0.05. B) Corresponding Western blotting analyses of NRF-1 and Tfam in protein extracts prepared from normoxic and hypoxic P14 brains (n=4). Molecular weight range is indicated for reference and β-actin signal is shown as loading control.

Article Snippet: PCR products were resolved in 1% agarose gels and analyzed by BioRad ChemiDoc XRS Image station with Quantity One software. table ft1 table-wrap mode="anchored" t5 caption a7 Target Gene Accession No. Primer Sequence Product Length NRF1 XM_231566 5′ATGGAGGAACACGGAGTGAC3′ 5′CCACAGAGACTGGAATCCCA3′ 592 bp Tfam NM_031326 5′GGAATGTGGGGCGTGCTAAGAA3′ 5′GCATTCAGTGGGCAGAAGTCCA3′ 869 bp PGC-1α NM_031347 5′TGTGAATGACCTGGACACAGACAGCT3′ 5′CGTCTTTGTGGCTTTTGCTGTTGAC3′ 489 bp β-Actin MN_031144 5′TGCTCCTCCTGAGCGCAAGTACTCT3′ 5′AGAACTTTGGGGGATGTTTGCTCCA3′ 385 bp Open in a separate window RT-PCR primers

Techniques: Reverse Transcription Polymerase Chain Reaction, Generated, Isolation, Software, Amplification, Western Blot, Molecular Weight